| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-04-03 05:44:45 |
| Analysis completed | 2025-04-03 05:44:45 |
| Wall time | 0:0:0 hours |
| locus | COI |
| preliminary_id | Aphididae |
| taxa_of_interest |
Aphis spiraecola Aphididae |
| country | Netherlands |
| host | Cut flower Paenonia |
| sample_id | VE24-1066_COI |
| Query DNA sequence |
>VE24-1066_COI AACTTTATATTTTTTATTTGGTATTTGATCAGGAATAATTGGATCTTCACTTAGAATTTT GATTCGATTAGAACTAAGTCAAATCAATTCAATTATCAATAATAACCAATTATATAATGT AATTGTTACAATTCATGCTTTTATTATAATTTTTTTTATAACTATACCAATTGTAATTGG TGGATTTGGAAATTGATTAATTCCTATAATAATAGGATGTCCAGATATATCTTTTCCACG ATTAAATAATATTAGATTCTGATTATTACCACCCTCATTAATAATAATAATTTGTAGATT CATAATTAATAATGGAACAGGAACAGGATGAACTATTTATCCACCTTTATCAAATAATAT TGCTCATAATAATATTTCAGTTGATTTAACCATCTTTTCTCTGCACTTAGCAGGTATTTC ATCAATTTTAGGAGCAATTAATTTTATTTGTACAATTCTTAATATAATACCAAACAATAT AAAATTAAATCAAATCCCACTATTTCCATGATCAATCTTAATTACAGCTATATTATTAAT TTTATCTCTACCAGTTCTAGCTGGTGCTATTACTATATTATTAACTGATCGAAATTTAAA TACATCATTTTTTGATCCAGCAGGAGGAGGAGACCCAATTCTTTATCAACACTTATTT
Inconclusive
The analyst should attempt subjective species identification at the genus level.
Reasoning - Flag 1C:
>3 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed | NA |
|
Inconclusive taxonomic identity (Flag 1C) |
|
| Taxa of interest ruled out | False |
|
Flag 2B: Taxon of interest detected Flag 5.1NA: Assessment of related species is only possible for taxa at rank genus/species Flag 5.2NA: Assessment of related species is only possible for taxa at rank genus/species |
|
Flag 1C:
The analyst should attempt subjective species identification at the genus level
>3 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits are then classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 292 | 6 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
Hits per candidate species (top 10 candidates only)
| Species | Hits | Identity | E-value |
|---|---|---|---|
| Aphis spiraecola | 273 | 99.8% | 0.0 |
| Aphis fabae | 4 | 99.8% | 0.0 |
| Aphis pomi | 9 | 99.8% | 0.0 |
| Aphis sp. BOLD:AAA4183 | 3 | 99.8% | 0.0 |
| Aphididae sp. BOLD:AAA4183 | 2 | 99.8% | 0.0 |
| Aphis gossypii | 1 | 99.5% | 0.0 |
| # | Accession | Hit subject | Align length | Query coverage | Score | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | MT445566 | Aphis spiraecola isolate Pometum (DK) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 2 | AB506735 | Aphis spiraecola mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Aspi1 | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 3 | MN319941 | Aphis spiraecola voucher NIBGE APH-00631 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 4 | MN320240 | Aphis spiraecola voucher NIBGE APH-00321 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 5 | MW315438 | Aphis spiraecola voucher A34 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 6 | PQ157613 | Aphis spiraecola isolate CITHAs4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 7 | KY837424 | Aphis spiraecola voucher BIOUG02527-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 8 | MN319946 | Aphis spiraecola voucher NIBGE APH-00696 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 9 | KY844604 | Aphis spiraecola voucher BIOUG02527-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 10 | PQ164396 | Aphis spiraecola isolate CITHAs5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 11 | KY842196 | Aphis spiraecola voucher BIOUG02439-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 12 | MN320096 | Aphis spiraecola voucher NIBGE APH-00587 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 13 | KY835246 | Aphis spiraecola voucher BIOUG02439-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 14 | MH632734 | Aphis spiraecola isolate AsPOIV cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 15 | MW315443 | Aphis spiraecola voucher A39 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 16 | PQ157565 | Aphis spiraecola isolate CITHAs1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 17 | KY842009 | Aphis spiraecola voucher BIOUG02527-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 18 | MN320226 | Aphis spiraecola voucher NIBGE APH-00643 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 19 | NC_053819 | Aphis spiraecola mitochondrion, complete genome | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 20 | KY836697 | Aphis spiraecola voucher BIOUG02527-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 21 | MN320191 | Aphis spiraecola voucher NIBGE APH-00649 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 22 | KY000675 | Aphis spiraecola voucher Apspir-2016 cytochrome c oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 23 | MW315446 | Aphis spiraecola voucher A42 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 24 | KY833484 | Aphis spiraecola voucher BIOUG02527-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 25 | MW315448 | Aphis spiraecola voucher A44 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 26 | KY833260 | Aphis spiraecola voucher BIOUG02439-F05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 27 | KY842435 | Aphis spiraecola voucher BIOUG02439-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 28 | MH632732 | Aphis spiraecola isolate AsPOMM cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 29 | MG954458 | Aphis spiraecola isolate Y11-1 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 30 | KY833259 | Aphis spiraecola voucher BIOUG02439-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 31 | MH632733 | Aphis spiraecola isolate AsCOUR cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 32 | MH407717 | Aphis spiraecola isolate AS34_F cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 33 | KY841003 | Aphis spiraecola voucher BIOUG02439-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 34 | KY841618 | Aphis spiraecola voucher BIOUG02439-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 35 | KY841985 | Aphis spiraecola voucher BIOUG02439-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 36 | PQ164413 | Aphis spiraecola isolate CITHAs7 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 37 | MN319745 | Aphis spiraecola voucher NIBGE APH-00642 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 38 | PQ157581 | Aphis spiraecola isolate CITHAs2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 39 | MG954457 | Aphis spiraecola isolate Y10-3 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 40 | MH407716 | Aphis spiraecola isolate AH36_F cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 41 | PQ164404 | Aphis spiraecola isolate CITHAs6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 42 | KY844751 | Aphis spiraecola voucher BIOUG02439-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 43 | MN320037 | Aphis spiraecola voucher NIBGE APH-00347 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 44 | PQ157588 | Aphis spiraecola isolate CITHAs3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 45 | MN320342 | Aphis spiraecola voucher NIBGE APH-00453 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 46 | MN319958 | Aphis spiraecola voucher NIBGE APH-00664 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 47 | EU701492 | Aphis spiraecola voucher CNC#HEM039576 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 48 | KY832517 | Aphis spiraecola voucher BIOUG02439-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 49 | MN319732 | Aphis spiraecola voucher NIBGE APH-00439 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 655.0 | 0.00e+00 | 99.8% |
| 50 | KJ702456 | Aphis spiraecola voucher ROAsAp3-14 cytochrome c oxidase subunit 1 (cox1) gene, partial cds; mitochondrial | 657 | 99.8% | 654.0 | 0.00e+00 | 99.8% |
| 51 | KR036921 | Aphis spiraecola voucher BIOUG00906-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 654.0 | 0.00e+00 | 99.8% |
| 52 | MW315425 | Aphis spiraecola voucher A21 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 651 | 98.9% | 648.0 | 0.00e+00 | 99.8% |
| 53 | KR037466 | Aphis spiraecola voucher CNC#HEM059491 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 98.5% | 645.0 | 0.00e+00 | 99.8% |
| 54 | KY832954 | Aphis spiraecola voucher BIOUG02527-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 98.3% | 644.0 | 0.00e+00 | 99.8% |
| 55 | MN320039 | Aphis spiraecola voucher NIBGE APH-00665 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 98.3% | 644.0 | 0.00e+00 | 99.8% |
| 56 | KY831140 | Aphis spiraecola voucher BIOUG02527-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 644 | 97.9% | 641.0 | 0.00e+00 | 99.8% |
| 57 | KY586082 | Aphis spiraecola isolate Gwalior_A8 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 97.1% | 636.0 | 0.00e+00 | 99.8% |
| 58 | KY586081 | Aphis spiraecola isolate Gwalior_A7 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 97.1% | 636.0 | 0.00e+00 | 99.8% |
| 59 | KY586078 | Aphis spiraecola isolate Gwalior_A3 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 97.1% | 636.0 | 0.00e+00 | 99.8% |
| 60 | KR030794 | Aphis spiraecola voucher CNC#HEM071354 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 97.1% | 636.0 | 0.00e+00 | 99.8% |
| 61 | KR032814 | Aphis spiraecola voucher 10BBCHEM-0571 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 95.6% | 626.0 | 0.00e+00 | 99.8% |
| 62 | MK547632 | Aphis spiraecola isolate OAI726 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 627 | 95.3% | 624.0 | 0.00e+00 | 99.8% |
| 63 | KR031910 | Aphis spiraecola voucher CNC#HEM070783 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 94.7% | 620.0 | 0.00e+00 | 99.8% |
| 64 | KR042276 | Aphis spiraecola voucher CNC#HEM070776 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 94.4% | 618.0 | 0.00e+00 | 99.8% |
| 65 | MN320265 | Aphis spiraecola voucher NIBGE APH-00199 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 93.3% | 611.0 | 0.00e+00 | 99.8% |
| 66 | KJ467505 | Aphis spiraecola cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 607 | 92.2% | 604.0 | 0.00e+00 | 99.8% |
| 67 | MG027897 | Aphis spiraecola isolate MVV121189.22 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 605 | 91.9% | 602.0 | 0.00e+00 | 99.8% |
| 68 | MN320019 | Aphis spiraecola voucher NIBGE APH-00217 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 604 | 91.8% | 601.0 | 0.00e+00 | 99.8% |
| 69 | MN320330 | Aphis spiraecola voucher NIBGE APH-00198 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 91.5% | 599.0 | 0.00e+00 | 99.8% |
| 70 | MN320186 | Aphis spiraecola voucher NIBGE APH-00200 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 91.5% | 599.0 | 0.00e+00 | 99.8% |
| 71 | MN320198 | Aphis spiraecola voucher NIBGE APH-00201 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 91.5% | 599.0 | 0.00e+00 | 99.8% |
| 72 | MN319875 | Aphis spiraecola voucher NIBGE APH-00265 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 91.5% | 599.0 | 0.00e+00 | 99.8% |
| 73 | MN319786 | Aphis spiraecola voucher NIBGE APH-00202 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 91.5% | 599.0 | 0.00e+00 | 99.8% |
| 74 | MW412105 | Aphis fabae isolate Ap12 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial. | 598 | 90.9% | 595.0 | 0.00e+00 | 99.8% |
| 75 | MW412103 | Aphis spiraecola isolate Ap1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial. | 598 | 90.9% | 595.0 | 0.00e+00 | 99.8% |
| 76 | MW412106 | Aphis pomi isolate Ap13 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial. | 595 | 90.4% | 592.0 | 0.00e+00 | 99.8% |
| 77 | KR577026 | Aphis sp. BOLD:AAA4183 voucher BIOUG07811-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 592 | 90.0% | 589.0 | 0.00e+00 | 99.8% |
| 78 | KR566608 | Aphis sp. BOLD:AAA4183 voucher BIOUG16167-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 591 | 89.8% | 588.0 | 0.00e+00 | 99.8% |
| 79 | KR578850 | Aphis spiraecola voucher BIOUG07158-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 589 | 89.5% | 586.0 | 0.00e+00 | 99.8% |
| 80 | MG169271 | Aphis spiraecola voucher BIOUG25754-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 588 | 89.4% | 585.0 | 0.00e+00 | 99.8% |
| 81 | KR583489 | Aphis spiraecola voucher BIOUG08805-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 583 | 88.6% | 580.0 | 0.00e+00 | 99.8% |
| 82 | KR565197 | Aphididae sp. BOLD:AAA4183 voucher BIOUG09129-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 582 | 88.4% | 579.0 | 0.00e+00 | 99.8% |
| 83 | KR573224 | Aphis spiraecola voucher BIOUG07898-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 579 | 88.0% | 576.0 | 0.00e+00 | 99.8% |
| 84 | KR561329 | Aphis sp. BOLD:AAA4183 voucher BIOUG07800-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 577 | 87.7% | 574.0 | 0.00e+00 | 99.8% |
| 85 | KR037785 | Aphis spiraecola voucher CHAN-2006-0202 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 576 | 87.5% | 573.0 | 0.00e+00 | 99.8% |
| 86 | KR574458 | Aphis spiraecola voucher BIOUG08805-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 572 | 86.9% | 569.0 | 0.00e+00 | 99.8% |
| 87 | JN214361 | Aphis spiraecola isolate Mc1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 570 | 86.6% | 567.0 | 0.00e+00 | 99.8% |
| 88 | MG166603 | Aphis spiraecola voucher BIOUG27402-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 567 | 86.2% | 564.0 | 0.00e+00 | 99.8% |
| 89 | OM611898 | Aphis spiraecola voucher BIOUG13513-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 567 | 86.2% | 564.0 | 0.00e+00 | 99.8% |
| 90 | OM576727 | Aphis spiraecola voucher BIOUG22992-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 567 | 86.2% | 564.0 | 0.00e+00 | 99.8% |
| 91 | OM546907 | Aphis spiraecola voucher BIOUG12772-C12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 567 | 86.2% | 564.0 | 0.00e+00 | 99.8% |
| 92 | KR560659 | Aphididae sp. BOLD:AAA4183 voucher BIOUG08415-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 567 | 86.2% | 564.0 | 0.00e+00 | 99.8% |
| 93 | MG168891 | Aphis spiraecola voucher BIOUG23313-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 564 | 85.7% | 561.0 | 0.00e+00 | 99.8% |
| 94 | MG167194 | Aphis spiraecola voucher BIOUG25754-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 561 | 85.3% | 558.0 | 0.00e+00 | 99.8% |
| 95 | MG169427 | Aphis spiraecola voucher BIOUG22100-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 561 | 85.3% | 558.0 | 0.00e+00 | 99.8% |
| 96 | MH821422 | Aphis spiraecola voucher HL712 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 97 | MH821522 | Aphis spiraecola voucher HLZ208 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 98 | MH821372 | Aphis spiraecola voucher HL180 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 99 | MH821406 | Aphis spiraecola voucher HL479 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 100 | MH821474 | Aphis spiraecola voucher HLshujia617 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 101 | MH821371 | Aphis spiraecola voucher HL177 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 102 | MH821535 | Aphis spiraecola voucher HLZ82 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 103 | MH821484 | Aphis spiraecola voucher HLshujia712 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 104 | MH821477 | Aphis spiraecola voucher HLshujia65 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 105 | MH821461 | Aphis spiraecola voucher HLshujia485 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 106 | MH821455 | Aphis spiraecola voucher HLshujia408 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 107 | MH821436 | Aphis spiraecola voucher HLshujia275 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 108 | MH821504 | Aphis spiraecola voucher HLshujia86 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 109 | MH821390 | Aphis spiraecola voucher HL332 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 110 | MH821382 | Aphis spiraecola voucher HL291 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 111 | MH821448 | Aphis spiraecola voucher HLshujia372 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 112 | MH821414 | Aphis spiraecola voucher HL603 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 113 | MH821426 | Aphis spiraecola voucher HLshujia135 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 114 | MH821439 | Aphis spiraecola voucher HLshujia319 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 115 | MH821407 | Aphis spiraecola voucher HL500 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 116 | MH821413 | Aphis spiraecola voucher HL602 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 117 | MH821395 | Aphis spiraecola voucher HL343 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 118 | MH821479 | Aphis spiraecola voucher HLshujia658 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 119 | MH821445 | Aphis spiraecola voucher HLshujia356 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 120 | MH821389 | Aphis spiraecola voucher HL331 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 121 | MH821376 | Aphis spiraecola voucher HL201 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 122 | MH821421 | Aphis spiraecola voucher HL663 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 123 | MH821488 | Aphis spiraecola voucher HLshujia724 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 124 | MH821527 | Aphis spiraecola voucher HLZ288 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 125 | MH821499 | Aphis spiraecola voucher HLshujia801 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 126 | MH821536 | Aphis spiraecola voucher HLZ99 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 127 | MH821531 | Aphis spiraecola voucher HLZ379 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 128 | MH821465 | Aphis spiraecola voucher HLshujia503 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 129 | MH821411 | Aphis spiraecola voucher HL569 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 130 | MH821435 | Aphis spiraecola voucher HLshujia273 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 131 | MH821481 | Aphis spiraecola voucher HLshujia682 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 132 | MH821403 | Aphis spiraecola voucher HL453 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 133 | MH821399 | Aphis spiraecola voucher HL361 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 134 | MH821443 | Aphis spiraecola voucher HLshujia354 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 135 | MH821373 | Aphis spiraecola voucher HL183 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 136 | MH821532 | Aphis spiraecola voucher HLZ388 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 137 | MH821510 | Aphis spiraecola voucher HLY_47 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 138 | MH821369 | Aphis spiraecola voucher HL101 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 139 | MH821374 | Aphis spiraecola voucher HL195 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 140 | MH821381 | Aphis spiraecola voucher HL275 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 141 | MH821520 | Aphis spiraecola voucher HLZ201 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 142 | MH821511 | Aphis spiraecola voucher HLYam_60 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 143 | MH821400 | Aphis spiraecola voucher HL378 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 144 | MH821500 | Aphis spiraecola voucher HLshujia807 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 145 | MH821396 | Aphis spiraecola voucher HL344 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 146 | MH821424 | Aphis spiraecola voucher HLshujia131 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 147 | MH821507 | Aphis spiraecola voucher HLshujia891 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 148 | MH821469 | Aphis spiraecola voucher HLshujia577 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 149 | MH821444 | Aphis spiraecola voucher HLshujia355 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 150 | MH821394 | Aphis spiraecola voucher HL341 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 151 | MH821388 | Aphis spiraecola voucher HL330 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 152 | MH821526 | Aphis spiraecola voucher HLZ283 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 153 | MH821529 | Aphis spiraecola voucher HLZ378 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 154 | MH821523 | Aphis spiraecola voucher HLZ245 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 155 | MH821398 | Aphis spiraecola voucher HL347 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 156 | MH821410 | Aphis spiraecola voucher HL568 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 157 | MH821446 | Aphis spiraecola voucher HLshujia357 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 158 | MH821434 | Aphis spiraecola voucher HLshujia247 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 159 | MH821423 | Aphis spiraecola voucher HLshujia124 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 160 | MH821521 | Aphis spiraecola voucher HLZ207 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 161 | MH821468 | Aphis spiraecola voucher HLshujia534 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 162 | MH821391 | Aphis spiraecola voucher HL336 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 163 | MH821377 | Aphis spiraecola voucher HL212 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 164 | MH821534 | Aphis spiraecola voucher HLZ63 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 165 | MH821458 | Aphis spiraecola voucher HLshujia437 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 166 | MH821420 | Aphis spiraecola voucher HL652 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 167 | MH821380 | Aphis spiraecola voucher HL250 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 168 | MH821378 | Aphis spiraecola voucher HL232 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 169 | MH821450 | Aphis spiraecola voucher HLshujia387 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 170 | MH821393 | Aphis spiraecola voucher HL339 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 171 | MH821387 | Aphis spiraecola voucher HL318 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 557.0 | 0.00e+00 | 99.8% |
| 172 | KY835683 | Aphis spiraecola voucher BIOUG15298-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 84.3% | 552.0 | 0.00e+00 | 99.8% |
| 173 | MK547637 | Aphis spiraecola isolate OAI735 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 555 | 84.3% | 552.0 | 0.00e+00 | 99.8% |
| 174 | OM550376 | Aphis spiraecola voucher BIOUG22479-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 84.3% | 552.0 | 0.00e+00 | 99.8% |
| 175 | OM545779 | Aphis spiraecola voucher BIOUG22479-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 84.3% | 552.0 | 0.00e+00 | 99.8% |
| 176 | OM551684 | Aphis spiraecola voucher BIOUG12772-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 84.3% | 552.0 | 0.00e+00 | 99.8% |
| 177 | KY836784 | Aphis spiraecola voucher BIOUG17840-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 84.3% | 552.0 | 0.00e+00 | 99.8% |
| 178 | KY845891 | Aphis spiraecola voucher BIOUG15390-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 549 | 83.4% | 546.0 | 0.00e+00 | 99.8% |
| 179 | MG167587 | Aphis spiraecola voucher BIOUG24149-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 549 | 83.4% | 546.0 | 0.00e+00 | 99.8% |
| 180 | OM551014 | Aphis spiraecola voucher BIOUG22479-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 546 | 83.0% | 543.0 | 0.00e+00 | 99.8% |
| 181 | KR583353 | Aphis spiraecola voucher BIOUG07903-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 546 | 83.0% | 543.0 | 0.00e+00 | 99.8% |
| 182 | MN319979 | Aphis spiraecola voucher NIBGE APH-00633 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 653.0 | 0.00e+00 | 99.7% |
| 183 | MN320202 | Aphis spiraecola voucher NIBGE APH-00557 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 653.0 | 0.00e+00 | 99.7% |
| 184 | HQ112181 | Aphis spiraecola voucher ORP-2010-46 cytochrome oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 185 | FJ998564 | Aphis spiraecola voucher CNC#HEM039286 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 186 | MH632730 | Aphis spiraecola isolate AsCITR cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 187 | KP759543 | Aphis spiraecola voucher As G1-269 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 188 | MG954456 | Aphis spiraecola isolate Y2-4 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 189 | KP759544 | Aphis spiraecola voucher As Pa-248 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 190 | AB506736 | Aphis spiraecola mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Aspi2 | 658 | 100.0% | 652.0 | 0.00e+00 | 99.7% |
| 191 | KY586083 | Aphis spiraecola isolate Jalandhar_A2 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 97.1% | 633.0 | 0.00e+00 | 99.7% |
| 192 | KY586085 | Aphis spiraecola isolate Modipuram_A43 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 97.1% | 633.0 | 0.00e+00 | 99.7% |
| 193 | KM115471 | Aphis pomi voucher ZMIOZ LY073 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 631 | 95.9% | 625.0 | 0.00e+00 | 99.7% |
| 194 | KM115468 | Aphis pomi voucher ZMIOZ LY074 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 628 | 95.4% | 622.0 | 0.00e+00 | 99.7% |
| 195 | MH407726 | Aphis spiraecola isolate AS14_F cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 626 | 95.1% | 620.0 | 0.00e+00 | 99.7% |
| 196 | KJ502194 | Aphis spiraecola voucher 110728WH04 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 609 | 92.6% | 603.0 | 0.00e+00 | 99.7% |
| 197 | MN320062 | Aphis spiraecola voucher NIBGE APH-00216 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 604 | 91.8% | 599.0 | 0.00e+00 | 99.7% |
| 198 | MN320160 | Aphis spiraecola voucher NIBGE APH-00695 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 590 | 89.7% | 584.0 | 0.00e+00 | 99.7% |
| 199 | MH821401 | Aphis spiraecola voucher HL416 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 554.0 | 0.00e+00 | 99.6% |
| 200 | MH821493 | Aphis spiraecola voucher HLshujia748 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 554.0 | 0.00e+00 | 99.6% |
| 201 | MH821467 | Aphis spiraecola voucher HLshujia518 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 554.0 | 0.00e+00 | 99.6% |
| 202 | MH821466 | Aphis spiraecola voucher HLshujia51 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 554.0 | 0.00e+00 | 99.6% |
| 203 | MH821503 | Aphis spiraecola voucher HLshujia846 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 554.0 | 0.00e+00 | 99.6% |
| 204 | MH821402 | Aphis spiraecola voucher HL445 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 554.0 | 0.00e+00 | 99.6% |
| 205 | MH821370 | Aphis spiraecola voucher HL139 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 554.0 | 0.00e+00 | 99.6% |
| 206 | MH821489 | Aphis spiraecola voucher HLshujia726 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 554.0 | 0.00e+00 | 99.6% |
| 207 | MH821427 | Aphis spiraecola voucher HLshujia139 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 554.0 | 0.00e+00 | 99.6% |
| 208 | KY838627 | Aphis spiraecola voucher BIOUG17840-F05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 84.3% | 550.0 | 0.00e+00 | 99.6% |
| 209 | MH821447 | Aphis spiraecola voucher HLshujia361 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 551 | 83.7% | 545.0 | 0.00e+00 | 99.6% |
| 210 | JQ916116 | Aphis gossypii voucher ZMIOZ 15832 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 649.0 | 0.00e+00 | 99.5% |
| 211 | AB506737 | Aphis spiraecola mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Aspi3 | 658 | 100.0% | 649.0 | 0.00e+00 | 99.5% |
| 212 | FJ998576 | Aphis spiraecola voucher CNC#HEM054297 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 649.0 | 0.00e+00 | 99.5% |
| 213 | KY838533 | Aphis spiraecola voucher BIOUG02533-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 640 | 97.3% | 631.0 | 0.00e+00 | 99.5% |
| 214 | KJ502195 | Aphis spiraecola voucher 110718WH39 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 630 | 95.7% | 621.0 | 0.00e+00 | 99.5% |
| 215 | KR573495 | Aphis spiraecola voucher BIOUG08421-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 591 | 89.8% | 582.0 | 0.00e+00 | 99.5% |
| 216 | KR576913 | Aphis spiraecola voucher BIOUG07279-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 589 | 89.5% | 580.0 | 0.00e+00 | 99.5% |
| 217 | KR573647 | Aphis spiraecola voucher BIOUG16066-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 573 | 87.1% | 564.0 | 0.00e+00 | 99.5% |
| 218 | MH821415 | Aphis spiraecola voucher HL604 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 551.0 | 0.00e+00 | 99.5% |
| 219 | MH821525 | Aphis spiraecola voucher HLZ259 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 551.0 | 0.00e+00 | 99.5% |
| 220 | MH821485 | Aphis spiraecola voucher HLshujia713 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 551.0 | 0.00e+00 | 99.5% |
| 221 | MH821428 | Aphis spiraecola voucher HLshujia140 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 551.0 | 0.00e+00 | 99.5% |
| 222 | KY834103 | Aphis spiraecola voucher BIOUG15298-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 84.3% | 548.0 | 0.00e+00 | 99.5% |
| 223 | MN320152 | Aphis spiraecola voucher NIBGE APH-00586 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 649.0 | 0.00e+00 | 99.4% |
| 224 | JX844401 | Aphis pomi voucher ZMIOZ 23256 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 225 | FJ998581 | Aphis spiraecola voucher CNC#HEM056615 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 226 | MG954459 | Aphis spiraecola isolate Y11-2 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 227 | MT445569 | Aphis spiraecola isolate Trdosovce (SK) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 228 | JX844372 | Aphis spiraecola voucher ZMIOZ 14330 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 229 | MT445571 | Aphis spiraecola isolate Sittingbourne (UK) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 230 | MT445572 | Aphis spiraecola isolate Bile Podoli (CZ) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 231 | MT445570 | Aphis spiraecola isolate West Malling (UK) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 232 | MT445573 | Aphis spiraecola isolate Mihalyi (HU) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 233 | MT445567 | Aphis spiraecola isolate Llugaxhi orchard 2 (KOS) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 234 | MT445577 | Aphis spiraecola isolate East Malling (UK) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 235 | MZ662895 | Aphis spiraecola isolate YamAphid-5A-YWA-2020 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 236 | MT445575 | Aphis spiraecola isolate Holovousy orchard 1 (CZ) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 237 | MT445576 | Aphis spiraecola isolate Holovousy orchard 2 (CZ) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 238 | MZ662877 | Aphis spiraecola isolate YamAphid-2L-YWA-2017 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 239 | MZ662882 | Aphis spiraecola isolate YamAphid-2B-YWA-2018 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 240 | MZ662878 | Aphis spiraecola isolate YamAphid-3A-YWA-2017 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 241 | MZ662876 | Aphis spiraecola isolate YamAphid-1L-YWA-2017 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 242 | MT445568 | Aphis spiraecola isolate Llugaxhi orchard 1 (KOS) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 646.0 | 0.00e+00 | 99.4% |
| 243 | KM115473 | Aphis pomi voucher ZMIOZ LY076 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 646 | 98.2% | 634.0 | 0.00e+00 | 99.4% |
| 244 | MW412104 | Aphis fabae isolate Ap11 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial. | 598 | 90.9% | 586.0 | 0.00e+00 | 99.3% |
| 245 | MW412111 | Aphis pomi isolate Ap19 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial. | 598 | 90.9% | 586.0 | 0.00e+00 | 99.3% |
| 246 | MW412112 | Aphis fabae isolate Ap3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial. | 598 | 90.9% | 586.0 | 0.00e+00 | 99.3% |
| 247 | MW412113 | Aphis fabae isolate Ap4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial. | 574 | 87.2% | 562.0 | 0.00e+00 | 99.3% |
| 248 | JN214362 | Aphis spiraecola isolate Mc2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 570 | 86.6% | 558.0 | 0.00e+00 | 99.3% |
| 249 | OM611433 | Aphis spiraecola voucher BIOUG13513-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 567 | 86.2% | 555.0 | 0.00e+00 | 99.3% |
| 250 | MH821379 | Aphis spiraecola voucher HL241 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 548.0 | 0.00e+00 | 99.3% |
| 251 | MH821383 | Aphis spiraecola voucher HL314 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 548.0 | 0.00e+00 | 99.3% |
| 252 | MH821502 | Aphis spiraecola voucher HLshujia827 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 548.0 | 0.00e+00 | 99.3% |
| 253 | MH821482 | Aphis spiraecola voucher HLshujia692 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 548.0 | 0.00e+00 | 99.3% |
| 254 | MH821494 | Aphis spiraecola voucher HLshujia775 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 548.0 | 0.00e+00 | 99.3% |
| 255 | MH821501 | Aphis spiraecola voucher HLshujia808 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 548.0 | 0.00e+00 | 99.3% |
| 256 | MH821496 | Aphis spiraecola voucher HLshujia792 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 548.0 | 0.00e+00 | 99.3% |
| 257 | MH821478 | Aphis spiraecola voucher HLshujia651 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 548.0 | 0.00e+00 | 99.3% |
| 258 | MH821432 | Aphis spiraecola voucher HLshujia194 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 548.0 | 0.00e+00 | 99.3% |
| 259 | MH821433 | Aphis spiraecola voucher HLshujia197 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 548.0 | 0.00e+00 | 99.3% |
| 260 | MH821498 | Aphis spiraecola voucher HLshujia800 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 548.0 | 0.00e+00 | 99.3% |
| 261 | MH821384 | Aphis spiraecola voucher HL315 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 548.0 | 0.00e+00 | 99.3% |
| 262 | MH821491 | Aphis spiraecola voucher HLshujia736 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 548.0 | 0.00e+00 | 99.3% |
| 263 | PP917990 | Aphis spiraecola voucher ZGMB HJAs cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 643.0 | 0.00e+00 | 99.2% |
| 264 | MH714463 | Aphis spiraecola voucher AP15 cytochrome oxidase subunit 1 (CO1) gene, partial cds; mitochondrial | 642 | 97.6% | 627.0 | 0.00e+00 | 99.2% |
| 265 | KY586079 | Aphis spiraecola isolate Gwalior_A5 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 97.1% | 624.0 | 0.00e+00 | 99.2% |
| 266 | ON461370 | Aphis spiraecola voucher 0821 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 619 | 94.1% | 604.0 | 0.00e+00 | 99.2% |
| 267 | MK184484 | Aphis pomi voucher AP0V11 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 600 | 91.2% | 585.0 | 0.00e+00 | 99.2% |
| 268 | MK281581 | Aphis pomi cytochrome oxidase subunit 1 (CO1) gene, partial cds; mitochondrial | 600 | 91.2% | 585.0 | 0.00e+00 | 99.2% |
| 269 | MZ662881 | Aphis spiraecola isolate YamAphid-2A-YWA-2018 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 640.0 | 0.00e+00 | 99.1% |
| 270 | MH632731 | Aphis spiraecola isolate AsHIBI cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 640.0 | 0.00e+00 | 99.1% |
| 271 | KR856185 | Aphis spiraecola cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 640.0 | 0.00e+00 | 99.1% |
| 272 | KM115472 | Aphis pomi voucher ZMIOZ LY075 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 647 | 98.3% | 629.0 | 0.00e+00 | 99.1% |
| 273 | ON368711 | Aphis spiraecola voucher 200317amH43 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 582 | 88.4% | 567.0 | 0.00e+00 | 99.1% |
| 274 | MH821417 | Aphis spiraecola voucher HL631 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 275 | MH821513 | Aphis spiraecola voucher HLZ122 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 276 | MH821409 | Aphis spiraecola voucher HL563 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 277 | MH821524 | Aphis spiraecola voucher HLZ258 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 278 | MH821533 | Aphis spiraecola voucher HLZ47 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 279 | MH821412 | Aphis spiraecola voucher HL584 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 280 | MH821487 | Aphis spiraecola voucher HLshujia720 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 281 | MH821515 | Aphis spiraecola voucher HLZ171 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 282 | MH821437 | Aphis spiraecola voucher HLshujia283 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 283 | MH821517 | Aphis spiraecola voucher HLZ177 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 284 | MH821480 | Aphis spiraecola voucher HLshujia665 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 285 | MH821418 | Aphis spiraecola voucher HL639 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 286 | MH821514 | Aphis spiraecola voucher HLZ132 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 287 | MH821425 | Aphis spiraecola voucher HLshujia132 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 288 | MH821416 | Aphis spiraecola voucher HL614 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 289 | MH821492 | Aphis spiraecola voucher HLshujia742 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 290 | MH821512 | Aphis spiraecola voucher HLZ120 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 545.0 | 0.00e+00 | 99.1% |
| 291 | KY586084 | Aphis spiraecola isolate Jalandhar A3 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 97.1% | 618.0 | 0.00e+00 | 98.9% |
| 292 | MH821528 | Aphis spiraecola voucher HLZ377 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 560 | 85.1% | 542.0 | 0.00e+00 | 98.9% |
| 293 | EU701320 | Aphis sp. BOLD:AAA4183 voucher CNC#HEM113514 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 616.0 | 0.00e+00 | 97.9% |
| 294 | MK241551 | Aphis spiraecola voucher AP0E12 cytochrome oxidase subunit 1 (CO1) gene, partial cds; mitochondrial | 600 | 91.2% | 555.0 | 0.00e+00 | 97.5% |
| 295 | KM115512 | Aphis spiraecola voucher ZMIOZ ZZM008 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 649 | 98.6% | 598.0 | 0.00e+00 | 97.4% |
| 296 | KP189463 | Aphis spiraecola voucher ORP SP-LK146 cytochrome oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 604.0 | 0.00e+00 | 97.3% |
| 297 | DQ499028 | Aphis spiraecola cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 600.0 | 0.00e+00 | 97.1% |
| 298 | AB506738 | Aphis spiraecola mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Aspi4 | 658 | 100.0% | 598.0 | 0.00e+00 | 97.0% |
| 299 | KY586080 | Aphis spiraecola isolate Gwalior_A6 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 97.1% | 579.0 | 0.00e+00 | 96.9% |
| 300 | JQ916095 | Aphis spiraecola voucher ZMIOZ 13737 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 657 | 99.8% | 564.0 | 0.00e+00 | 95.3% |
| 301 | KR034120 | Aphis maculatae voucher CHU06-APH-168 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 98.0% | 555.0 | 0.00e+00 | 95.3% |
| 302 | KR038391 | Aphis maculatae voucher CHU06-APH-086 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 98.0% | 555.0 | 0.00e+00 | 95.3% |
| 303 | KR033268 | Aphis maculatae voucher CHU06-APH-147 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 98.0% | 555.0 | 0.00e+00 | 95.3% |
| 304 | MT445574 | Aphis pomi isolate Mihalyi (HU) cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 622 | 94.5% | 535.0 | 0.00e+00 | 95.3% |
| 305 | EU701544 | Braggia urovaneta voucher CNC#HEM054170 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 306 | EU701446 | Aphis maculatae voucher CNC#HEM006908 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 562.0 | 0.00e+00 | 95.1% |
| 307 | KR032354 | Aphis maculatae voucher CNC#HEM056835 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 561.0 | 0.00e+00 | 95.1% |
| 308 | EU701476 | Aphis pomi voucher CNC#HEM039277 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 561.0 | 0.00e+00 | 95.1% |
| 309 | EU701478 | Aphis pomi voucher CNC#HEM033921 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 561.0 | 0.00e+00 | 95.1% |
| 310 | KR039601 | Aphis maculatae voucher CNC#HEM057465 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 559.0 | 0.00e+00 | 95.0% |
| 311 | KF638995 | Aphis pomi voucher INRA CBGP ACOE1257/chasses1257-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 558.0 | 0.00e+00 | 95.0% |
| 312 | KR042798 | Aphis pomi voucher CNC#HEM054263 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 558.0 | 0.00e+00 | 95.0% |
| 313 | GQ904107 | Aphis neospiraeae isolate 030523SH25 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 558.0 | 0.00e+00 | 95.0% |
| 314 | KR033472 | Aphis maculatae voucher CNC#HEM059939 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 655 | 99.5% | 556.0 | 0.00e+00 | 95.0% |
| 315 | HQ900843 | Aphis pomi isolate FUM 6 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 638 | 97.0% | 542.0 | 0.00e+00 | 95.0% |
| 316 | MT302350 | Aphis pomi voucher 3_n1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 635 | 96.5% | 539.0 | 0.00e+00 | 95.0% |
| 317 | PP627400 | Aphis pomi isolate CITHAp1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 635 | 96.5% | 539.0 | 0.00e+00 | 95.0% |
| 318 | MT302349 | Aphis pomi voucher 2_g1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 635 | 96.5% | 539.0 | 0.00e+00 | 95.0% |
| 319 | HM416737 | Aphis pomi voucher CNC#HEM064282 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 96.4% | 538.0 | 0.00e+00 | 95.0% |
| 320 | FJ998516 | Aphis pomi voucher CNC#HEM032174 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 557.0 | 0.00e+00 | 94.8% |
| 321 | KF638749 | Aphis brotericola voucher INRA CBGP ACOE1449/chasses1449-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 322 | OR091476 | Aphis celastrii isolate S09 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 556.0 | 0.00e+00 | 94.8% |
| 323 | MT302351 | Aphis pomi voucher 1_k1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 635 | 96.5% | 536.0 | 0.00e+00 | 94.8% |
| 324 | EU701546 | Braggia urovaneta voucher CNC#HEM113654 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 325 | EU701545 | Braggia urovaneta voucher CNC#HEM054158 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 326 | JQ916118 | Aphis kurosawai voucher ZMIOZ 15982 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 553.0 | 0.00e+00 | 94.7% |
| 327 | GQ904106 | Aphis kurosawai isolate 050603HJ16 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 550.0 | 0.00e+00 | 94.5% |
| 328 | KF639103 | Aphis verbasci voucher INRA CBGP ACOE2026/chasses2026-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 547.0 | 0.00e+00 | 94.4% |
| 329 | JQ916098 | Aphis anuraphoides voucher ZMIOZ 13874 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 651 | 98.9% | 540.0 | 0.00e+00 | 94.3% |
| 330 | KR041033 | Aphis astragalina voucher CNC#HEM039981 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 544.0 | 0.00e+00 | 94.2% |
| 331 | HM432515 | Aphis sp. RFBAE387-09 voucher CNC#HEM063328 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 544.0 | 0.00e+00 | 94.2% |
| 332 | EU701537 | Brachyunguis tetrapteralis voucher CNC#HEM054151 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 544.0 | 0.00e+00 | 94.2% |
| 333 | EU701540 | Braggia eriogoni voucher CNC#HEM026463 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 544.0 | 0.00e+00 | 94.2% |
| 334 | KF639104 | Aphis verbasci voucher INRA CBGP ACOE432/chasses432-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 544.0 | 0.00e+00 | 94.2% |
| 335 | KF639099 | Aphis vallei voucher INRA CBGP ACOE2444/chasses2444-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 544.0 | 0.00e+00 | 94.2% |
| 336 | KF639098 | Aphis vallei voucher INRA CBGP ACOE1475/chasses1475-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 544.0 | 0.00e+00 | 94.2% |
| 337 | KF638912 | Aphis galiiscabri voucher INRA CBGP ACOE1612/chasses1612-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 544.0 | 0.00e+00 | 94.2% |
| 338 | KF639380 | Ephedraphis ephedrae voucher INRA CBGP ACOE575/chasses575-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 544.0 | 0.00e+00 | 94.2% |
| 339 | KR571863 | Aphis sp. BOLD-2016 voucher BIOUG04209-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 544.0 | 0.00e+00 | 94.2% |
| 340 | GQ377866 | Braggia eriogoni voucher CNC#HEM061765 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 544.0 | 0.00e+00 | 94.2% |
| 341 | GU668704 | Aphis astragalina voucher CNC#HEM063715 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 544.0 | 0.00e+00 | 94.2% |
| 342 | MN671896 | Aphis sp. BOLD:ACF2671 voucher CHARS00039-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 654 | 99.4% | 540.0 | 0.00e+00 | 94.2% |
| 343 | MF834058 | Aphidinae sp. BIOUG14779-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 98.9% | 537.0 | 0.00e+00 | 94.2% |
| 344 | EU701541 | Braggia eriogoni voucher CNC#HEM033259 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 541.0 | 0.00e+00 | 94.1% |
| 345 | KR032325 | Aphis helianthi voucher CNC#HEM028897 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 541.0 | 0.00e+00 | 94.1% |
| 346 | KF638797 | Aphis cytisorum voucher INRA CBGP ACOE1505/chasses1505-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 541.0 | 0.00e+00 | 94.1% |
| 347 | HQ970842 | Aphis helianthi voucher CNC#HEM070009 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 541.0 | 0.00e+00 | 94.1% |
| 348 | KY323025 | Aphis fabae voucher AfKr5 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 541.0 | 0.00e+00 | 94.1% |
| 349 | KF639106 | Aphis verbasci voucher INRA CBGP ACOE461/chasses461-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 541.0 | 0.00e+00 | 94.1% |
| 350 | KC502060 | Aphididae sp. BOLD:ABZ4520 voucher CCDB-08110-D02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 541.0 | 0.00e+00 | 94.1% |
| 351 | JF883731 | Aphis helianthi voucher CNC#HEM070712 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 541.0 | 0.00e+00 | 94.1% |
| 352 | KF638799 | Aphis cytisorum voucher INRA CBGP ACOE1959/chasses1959-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 541.0 | 0.00e+00 | 94.1% |
| 353 | EU701538 | Braggia eriogoni voucher CNC#HEM055868 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 541.0 | 0.00e+00 | 94.1% |
| 354 | JQ916094 | Aphis lhasaensis voucher ZMIOZ 13542 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 541.0 | 0.00e+00 | 94.1% |
| 355 | KF638913 | Aphis galiiscabri voucher INRA CBGP ACOE2012/chasses2012-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 541.0 | 0.00e+00 | 94.1% |
| 356 | EU701539 | Braggia eriogoni voucher CNC#HEM028589 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 541.0 | 0.00e+00 | 94.1% |
| 357 | KF638751 | Aphis caroliboerneri voucher INRA CBGP ACOE2478/chasses2478-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 541.0 | 0.00e+00 | 94.1% |
| 358 | MF831318 | Aphis rumicis voucher BIOUG27467-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 540.0 | 0.00e+00 | 94.1% |
| 359 | KF638755 | Aphis clematidis voucher INRA CBGP ACOE2482/chasses2482-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 540.0 | 0.00e+00 | 94.1% |
| 360 | KR045155 | Aphis astragalina voucher BIOUG02022-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 539.0 | 0.00e+00 | 93.9% |
| 361 | KY845876 | Aphis craccivora voucher BIOUG02533-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 362 | GQ904116 | Aphis oenotherae isolate 030625SH67 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 363 | KF638779 | Aphis craccivora voucher INRA CBGP ACOE1410/chasses1410-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 364 | MZ444691 | Aphis rogeri voucher NZMC_aphid 46792 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 365 | JQ916144 | Aphis lhasaensis voucher ZMIOZ 17309 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 366 | KR031480 | Aphis helianthi voucher CNC#HEM114036 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 367 | GQ377860 | Braggia agathona voucher CNC#HEM061783 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 368 | FJ429946 | Braggia eriogoni voucher CNC#HEM058074 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 369 | HQ970637 | Aphis astragalina voucher CNC#HEM070099 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 370 | PP952032 | Aphis craccivora strain AcLc_AM cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 371 | MN320340 | Aphis craccivora voucher NIBGE APH-00296 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 372 | MN319929 | Aphis craccivora voucher NIBGE APH-00065 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 373 | AB506711 | Aphis craccivora mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Acra1 | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 374 | KR569478 | Aphis pentstemonicola voucher BIOUG03700-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 375 | KF638800 | Aphis cytisorum voucher INRA CBGP ACOE1993/chasses1993-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 376 | MN319944 | Aphis craccivora voucher NIBGE APH-00380 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 377 | KY830692 | Aphis craccivora voucher BIOUG02439-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 378 | MZ444694 | Aphis rogeri voucher NZMC_aphid 49524 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 379 | HQ971231 | Aphis viburniphila voucher CNC#HEM064419 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 380 | KY322947 | Aphis craccivora voucher AfLa3 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 381 | KF639085 | Aphis ulicis voucher INRA CBGP ACOE1305/chasses1305-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 382 | MN319823 | Aphis craccivora voucher NIBGE APH-00146 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 383 | KY835106 | Aphis craccivora voucher BIOUG02439-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 384 | KR565376 | Aphis pentstemonicola voucher BIOUG05351-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 538.0 | 0.00e+00 | 93.9% |
| 385 | MK547618 | Aphis craccivora isolate OAI716 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 537.0 | 0.00e+00 | 93.9% |
| 386 | MN319854 | Brachyunguis harmalae voucher NIBGE APH-00311 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 537.0 | 0.00e+00 | 93.9% |
| 387 | EU701448 | Aphis manitobensis voucher CNC#HEM007694 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 537.0 | 0.00e+00 | 93.9% |
| 388 | HM405597 | Aphis schneideri voucher CGAEC-125 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 537.0 | 0.00e+00 | 93.9% |
| 389 | MT449693 | Aphis rumicis isolate Polygonaceae-Dokdo cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 537.0 | 0.00e+00 | 93.9% |
| 390 | OR098298 | Aphis sp. isolate B2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 99.8% | 537.0 | 0.00e+00 | 93.9% |
| 391 | MN320122 | Brachyunguis harmalae voucher NIBGE APH-00153 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 537.0 | 0.00e+00 | 93.9% |
| 392 | HQ970728 | Aphis oenotherae voucher CNC#HEM007153 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 537.0 | 0.00e+00 | 93.9% |
| 393 | JN644996 | Mollitrichosiphum tenuicorpus voucher ZMIOZ 22159 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 537.0 | 0.00e+00 | 93.9% |
| 394 | MN319899 | Brachyunguis harmalae voucher NIBGE APH-00152 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 537.0 | 0.00e+00 | 93.9% |
| 395 | KR042803 | Aphis varians voucher CNC#HEM061460 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 537.0 | 0.00e+00 | 93.9% |
| 396 | EU701295 | Aphis acaenovinae voucher CNC#HEM053814 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 99.8% | 537.0 | 0.00e+00 | 93.9% |
| 397 | AB506734 | Aphis rumicis mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Arum | 657 | 99.8% | 537.0 | 0.00e+00 | 93.9% |
| 398 | JQ916121 | Aphis rumicis voucher ZMIOZ 16193 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 657 | 99.8% | 537.0 | 0.00e+00 | 93.9% |
| 399 | JQ916145 | Aphis rumicis voucher ZMIOZ 17310 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 657 | 99.8% | 537.0 | 0.00e+00 | 93.9% |
| 400 | EU701481 | Aphis rubifolii voucher CNC#HEM049296 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 536.0 | 0.00e+00 | 93.8% |
| 401 | EU701480 | Aphis rubifolii voucher CNC#HEM049300 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 536.0 | 0.00e+00 | 93.8% |
| 402 | KR562124 | Aphis glycines voucher BIOUG01607-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 536.0 | 0.00e+00 | 93.8% |
| 403 | JQ916112 | Toxoptera aurantii voucher ZMIOZ 15645 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 404 | KR568414 | Braggia sp. BOLD-2016 voucher BIOUG03541-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 405 | KY846952 | Aphis craccivora voucher BIOUG02533-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 406 | MN320267 | Aphis craccivora voucher NIBGE APH-00133 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 407 | MN320178 | Aphis craccivora voucher NIBGE APH-00352 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 408 | MW491813 | Aphis craccivora isolate NM60 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 409 | MN320244 | Aphis craccivora voucher NIBGE APH-00419 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 410 | GU324658 | Aphis craccivora voucher ZMCAS 19963 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 411 | MW491811 | Aphis craccivora isolate NM16 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 412 | KX371821 | Aphis craccivora voucher ROApcracc2-16 cytochrome c oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 413 | MH407713 | Aphis craccivora isolate AC363_F cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 414 | KT889380 | Aphis glycines isolate Zhengzhou mitochondrion, partial genome | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 415 | MN320204 | Aphis craccivora voucher NIBGE APH-00103 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 416 | MW491791 | Aphis craccivora isolate NM37 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 417 | KR031842 | Aphis glycines voucher HUM-2006-1300 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 418 | KY834859 | Aphis craccivora voucher BIOUG02439-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 419 | KY836830 | Aphis craccivora voucher BIOUG02439-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 420 | MW491804 | Aphis craccivora isolate NM33 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 421 | MW491797 | Aphis craccivora isolate NM53 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 422 | MN319870 | Aphis craccivora voucher NIBGE APH-00318 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 423 | MN320190 | Aphis craccivora voucher NIBGE APH-00551 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 424 | KR037787 | Aphis viburniphila voucher CNC#HEM071306 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 425 | MN320347 | Aphis craccivora voucher NIBGE APH-00550 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 426 | NC_031387 | Aphis craccivora isolate Old_world mitochondrion, complete genome | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 427 | MZ662890 | Aphis craccivora isolate Aphid-10A-YWA-2019 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 428 | AB506723 | Aphis glycines mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Agly1 | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 429 | KY845926 | Aphis craccivora voucher BIOUG02527-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 430 | MZ444686 | Aphis rogeri voucher NZMC_aphid 46781 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 431 | MN319773 | Aphis craccivora voucher NIBGE APH-00330 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 432 | KY834492 | Aphis craccivora voucher BIOUG02533-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 433 | MN320110 | Aphis craccivora voucher NIBGE APH-00573 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 434 | MN319780 | Aphis craccivora voucher NIBGE APH-00298 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 435 | KR085004 | Aphis craccivora voucher Ac5 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 436 | MN320078 | Aphis craccivora voucher CCDB-23161-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 437 | MW491798 | Aphis craccivora isolate NM52 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 438 | MW491790 | Aphis craccivora isolate NM51 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 439 | EU701427 | Aphis helianthi voucher CNC#HEM112781 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 440 | MW491801 | Aphis craccivora isolate NM29 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 441 | KY838020 | Aphis craccivora voucher BIOUG02134-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 442 | KY837367 | Aphis craccivora voucher BIOUG02439-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 443 | AB506725 | Aphis glycines mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Agly3 | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 444 | KY842424 | Aphis craccivora voucher BIOUG02439-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 445 | MN320235 | Aphis craccivora voucher NIBGE APH-00293 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 446 | GU324628 | Aphis rumicis voucher ZMCAS 16309 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 447 | KR017752 | Aphis craccivora voucher DOGR 2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 448 | KY833152 | Aphis craccivora voucher BIOUG02527-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 449 | KR038668 | Aphis asclepiadis voucher CNC#HEM055765 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 450 | MN319842 | Aphis craccivora voucher NIBGE APH-00424 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 451 | MW491808 | Aphis craccivora isolate NM47 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 452 | GQ377862 | Braggia agathona voucher CNC#HEM061776 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 453 | OR888763 | Aphis craccivora isolate Ros3Tsr1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 454 | MN319955 | Aphis craccivora voucher NIBGE APH-00101 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 455 | MN319990 | Aphis craccivora voucher NIBGE APH-00446 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 456 | KY831028 | Aphis craccivora voucher BIOUG02527-D02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 457 | MN319894 | Aphis craccivora voucher NIBGE APH-00518 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 458 | MN319749 | Aphis craccivora voucher CCDB-23161-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 459 | KF639084 | Aphis ulicis voucher INRA CBGP ACOE1022/chasses1022-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 460 | MN320307 | Aphis craccivora voucher NIBGE APH-00310 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 461 | KR043749 | Aphis viburniphila voucher CNC#HEM007557 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 462 | MN320318 | Aphis craccivora voucher NIBGE APH-00132 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 463 | MW491795 | Aphis craccivora isolate NM48 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 464 | EU701309 | Aphis craccivora voucher CNC#HEM055010 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 465 | GQ377859 | Braggia agathona voucher CNC#HEM061784 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 466 | KC840675 | Aphis glycines mitochondrion, partial genome | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 467 | KR084996 | Aphis craccivora voucher Ac9 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 468 | KR084998 | Aphis craccivora voucher Ac7 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 469 | MN320070 | Aphis craccivora voucher NIBGE APH-00412 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 470 | MT095075 | Aphis craccivora mitochondrion, complete genome | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 471 | MN320291 | Aphis craccivora voucher CCDB-23161-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 472 | NC_045236 | Aphis glycines voucher FSCA:2018.5677 mitochondrion, complete genome | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 473 | MN319804 | Aphis craccivora voucher NIBGE APH-00423 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 474 | MN320343 | Aphis craccivora voucher NIBGE APH-00320 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 475 | KY831241 | Aphis craccivora voucher BIOUG02439-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 476 | MN319982 | Aphis craccivora voucher NIBGE APH-00131 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 477 | MN320346 | Aphis craccivora voucher NIBGE APH-00517 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 478 | MW491809 | Aphis craccivora isolate NM42 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 479 | KF638801 | Aphis cytisorum voucher INRA CBGP ACOE2275/chasses2275-ACDA cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 480 | KY844137 | Aphis craccivora voucher BIOUG02439-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 481 | GQ904082 | Aphis craccivora isolate 031026HJ1 cytochrome c oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 482 | MZ444692 | Aphis rogeri voucher NZMC_aphid 47585 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 483 | JQ920913 | Aphis glycines voucher ZMIOZ 1994 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 484 | MN320253 | Aphis craccivora voucher NIBGE APH-00441 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 485 | MN319756 | Aphis craccivora voucher CCDB-23161-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 486 | MW491810 | Aphis craccivora isolate NM40 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 487 | MN320092 | Aphis craccivora voucher NIBGE APH-00319 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 488 | MN319890 | Aphis craccivora voucher NIBGE APH-00345 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 489 | MW491792 | Aphis craccivora isolate NM43 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 490 | KY846980 | Aphis craccivora voucher BIOUG02439-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 491 | MW491789 | Aphis craccivora isolate NM31 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 492 | MT651326 | Aphis craccivora isolate DELIND01 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 493 | KR084997 | Aphis craccivora voucher Ac1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 494 | KY840930 | Aphis craccivora voucher BIOUG02527-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 495 | MW491803 | Aphis craccivora isolate NM34 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 496 | MN319880 | Aphis craccivora voucher NIBGE APH-00440 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 497 | KY836217 | Aphis craccivora voucher BIOUG02439-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 498 | MN320032 | Aphis craccivora voucher NIBGE APH-00343 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 499 | AB506715 | Aphis craccivora mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Acra5 | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
| 500 | MW491796 | Aphis craccivora isolate NM28 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 100.0% | 535.0 | 0.00e+00 | 93.8% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the identity (%) of BLAST hits grouped by genus. Each data point shows the alignment identity between the query and matched reference sequence. The analyst may wish to use this to make a subjective genus-level identification for the sample.
This sections shows the taxa of interest specified by the submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity |
|---|---|---|---|---|---|
| Aphis spiraecola | species | Aphis spiraecola | Aphis spiraecola | MT445566 | 0.998 |
| Aphididae | family | Aphididae | Aphis spiraecola | MT445566 | 0.998 |
See the Database coverage section to see database coverage for taxa of interest.
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
The target taxa include candidate species, the preliminary morphology ID, and any taxa of interest provided by the submitter. Each of these taxa are independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of the target taxon. Insufficient coverage of a taxon can result in that taxon not be correctly identified as the taxonomic identity of the sample. For example, if the sample is Homo sapiens, but Homo sapiens sequences are not included in the reference database, the analysis will be unable to identity Homo sapiens as the correct taxonomic identity, and will most likely assign the closest relative with reference data as the taxonomic identity.
Preliminary ID
Taxa of interest
Database coverage
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
There are NA sequences in the reference database for Aphididae at the given locus COI.
Database coverage
Flag 5.2B:
The database has some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 479 sequences in the reference database for Aphis spiraecola at the given locus COI.
Flag 5.2B:
The database has some support for species in this genus
Reasoning: 10-90% of related taxa have reference sequence(s) at the given locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Flag 5.3A:
Probability that a different related species from the country of origin is the true taxonomic identity: LOW
Reasoning: All species in genus from country of origin have reference sequence(s) for this locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Database coverage
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
There are NA sequences in the reference database for Aphididae at the given locus COI.
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |